tutorbin

molecular biology homework help

Boost your journey with 24/7 access to skilled experts, offering unmatched molecular biology homework help

tutorbin

Trusted by 1.1 M+ Happy Students

WhatsApp Support

Get Instant
Online Homework Help
via WhatsApp

Get instant homework help from top tutors—just a WhatsApp message away. 24/7 hw help support for all your academic needs!

A
S
M
R
★★★★★
2M+ students trust TutorBin
Your WhatsApp Number
phone
or
⚡ Instant reply
🔒 100% private
👨‍🏫 Top tutors
🌍 All subjects
*Get instant homework help from top tutors—just a WhatsApp message away. 24/7 support for all your academic needs!
2M+ Students Helped24/7 Live SupportExpert TutorsAll Subjects CoveredInstant Response100% ConfidentialTop Rated ServiceMoney-back Guarantee2M+ Students Helped24/7 Live SupportExpert TutorsAll Subjects CoveredInstant Response100% ConfidentialTop Rated ServiceMoney-back Guarantee

Recently Asked molecular biology Questions

Expert help when you need it
  • Q1:Write a one paragraph response explaining the four different perspectives below on human cloning. Introduce the authors’ full names (titles aren’t necessary for this paragraph, but they would be for an essay) to indicate each of their different opinions. Consider the most strategic way of how to organize/structure your paragraph to show connections and contrasts between each of the source’s arguments Use transitions carefully, as they will show how you relate the articles to each other. Perspective 1: Patricia Baird, “Should Human Cloning be Permitted?” “...In conclusion, using nuclear-transfer cloning to allow people to have a child introduces a different way of reproduction for our species. Once we breach this barrier, it leaves us with no place to stop. Given all the problems outlined, the reasons for permitting cloning to produce a person are insufficiently compelling. Even in the few circumstances where the case for human cloning seems justified, there are alternative solutions. We are at an appropriate stopping place on a slippery slope. Not all reasons why a person might wish to copy his or her cells are unethical, but given there are other options open to people wishing to form a family, concerns about individual and social harms from cloning are strong enough that it is not justified to permit it.” Perspective 2: Chris MacDonald, “Yes, Human Cloning Should be Permitted.” “The fact that a portion of society—even a majority—finds an activity distasteful is insufficient grounds for passing a law forbidding it....human cloning for reproductive purposes has legitimate, morally acceptable applications—for example for infertile couples, and for gay couples.” Perspective 3: Jacob M. Appel, “Should We Really Fear Reproductive Human Cloning?” “In an ideal world, human reproductive cloning would be safe, legal and rare. I say rare because my guess is that the vast majority of people, myself included, would have little desire to raise cloned offspring. After all, it is now possible to clone pet dogs--but few of us would choose to spend a spare $150,000 on such a venture. Yet thirty-eight years after James Watson's seminal essay, "Moving Toward the Clonal Man" called for increased public debate on this promising and perplexing subject, I don't believe that we should be so quick to greet cloning technology with a permanent injunction. Instead, what human reproductive cloning requires at the moment is a yellow light, telling us to proceed with extreme caution, until we know with confidence whether the technology can ever be used to produce healthy babies.” Perspective 4: Leon Kass, “The Wisdom of Repugnance” “We are repelled by the prospect of cloning human beings not because of the strangeness or novelty of the undertaking, but because we intuit and feel, immediately and without argument, the violation of things that we rightfully hold dear. Repugnance, here as elsewhere, revolts against the excesses of human wilfulness, warning us not to transgress what is unspeakably profound. Indeed, in this age in which everything is held to be permissible so long as it is freely done, in which our given human nature no longer commands respect, in which our bodies are regarded as mere instruments of our autonomous rational wills, repugnance may be the only voice left that speaks up to defend the central core of our humanity.” See Answer
  • Q2:b. C. d. What was the independent variable in this experiment? What was the dependent variable? What were the standardized variables?See Answer
  • Q3:e. f. g. Do the results support your hypothesis? Explain. At which temperature was the rate of osmosis greatest? What can you conclude about the effects of temperature on the rate of osmosis? Answer in terms of molecular energy.See Answer
  • Q4:h. Name at least two possible sources of error in this experiment. How could this experiment be improved?See Answer
  • Q5:Variables Table 1 - Osmosis: Effect of Temperature Cold Beaker Water temperature Tube mass Tube firmness Warm Beaker Room Temp Beaker Water temperature Tube mass Tube firmness Before After % Change Observations Water temperature Tube mass Tube firmnessSee Answer
  • Q6:HANDS-ON ACTIVITY#1: 1. Get 2 transparent glasses (same size) 2. Put the same volume of water in both of them. In one of the glasses put cold water and in the other glass put hot water. 3. Place the 2 glasses side by side and let the water sit for a few seconds. 4. Put a drop of food dye in each of the glasses. Use your cell phone to take a picture of this hands-on activity. You will need to submit this picture and your photo ID to DB 2. Answer the following questions: Why does 1 drop of the dye stain the entire volume of water? Does the staining of the entire volume of water happen faster/slower/or at the same speed in the hot water compared to the cold water? Why? HANDS-ON ACTIVITY#2: This experiment will take you 3 days to complete. Perform the experiment and answer questions 1 to 7 in this hand-out. Use your cell phone to take pictures of this hands-on activity. You will need to submit these pictures and your photo ID to DB 2. An unfertilized chicken egg contains a large cell surrounded by egg white, a shell membrane, and an egg shell. You will investigate how the size of an egg changes when the eggshell is removed and the egg is placed in different types of liquid. ➤ Get 2 eggs. To begin, record the weight or circumference of each egg in the day 1 row in the table. (Measure the circumference around the widest part, not lengthwise.) Day 1 2 Egg 1 Egg 2 Weight (grams) (or circumference (cm)) Weight (grams) (or circumference (cm)) (with shell) (with shell) (after a day in vinegar most of shell removed) (after a day in vinegar: most of shell removed)See Answer
  • Q7:3 (after a day in water) (after a day in corn syrup) Put each egg in a container labeled Egg 1 or Egg 2. Pour in enough vinegar to cover the egg. Cover the container. Do you see bubbles forming around the egg? These are bubbles of CO2 which result from the chemical reaction between the acetic acid in the vinegar and the calcium carbonate in the eggshell. This reaction will dissolve most of the eggshell by day 2. Day 2 ➤ Observe your eggs. Notice that most of the shell has been dissolved by the acetic acid in the vinegar. The shell membrane around the egg is fairly strong. However, the egg without its shell is fragile, so you will need to handle your eggs very gently and carefully! Rinse each egg and measure the weight or circumference of each egg. Record your results for day 2 in the above table. 1a. Did the eggs become heavier/larger or lighter/smaller 1b. What do you think happened to cause the change in the eggs' weight/size? ➤ Empty the vinegar from the container for egg 1 and rinse the container. Put egg 1 back in the container and add water to cover the egg. ➤ Empty the vinegar from the container for egg 2 and rinse the container. Put egg 2 back in the container and add corn syrup to cover the egg. Day 3 2. Compare and contrast the appearance of the egg that has been in water vs. the egg that has been in corn syrup. 3. You may be able to see a layer of water on top of the corn syrup. Where do you think this water came from? Rinse the corn syrup off of egg 2. Measure and record the weight and/or circumference of the egg for day 3 in the table on page 1. 4. Why did the egg placed in water get heavier and bigger? Where do you think the additional weight/volume came from?See Answer
  • Q8:5. What do you think happened to cause the change in weight/size of the egg placed in corn syrup? 6a. Recall that each egg is surrounded by a shell membrane. Based on your observations, which of the following do you think can cross this membrane? a. both water and the proteins in the egg white b. water, but not the proteins in the egg white c. the proteins in the egg white, but not water d. neither water nor the proteins in the egg white 6b. What evidence supports your conclusion? 7. The shell membrane that surrounds the egg is a selectively permeable membrane. Explain why "selectively permeable" is a good way to describe this membrane.See Answer
  • Q9: Imagine you have been recently hired by a biotech company. On your first day of work, the manager wants to see your ability to engineer proteins, so they ask you to design a protein expression system for making any protein you wish, but it should have some way after expression in E. coli BL21 to be purified by affinity chromatography. The manager gives you some advice and recommends you produce the protein with a HisTag so you can purify your protein with nickel affinity column chromatography which the company uses regularly. To make things easier since its your first day, the manager gives you a tube containing a proprietary expression vector that only your company has called pET 14p and it is this vector that you will need to use to insert the gene for the protein that you choose to make and purify. Before getting started on the actual experiments, the manager wants you to design the experimental setup and provide a report. The following 6 items (marked w/ **) should be included in your report along with an explanation for each step. Steps to follow in this design project for your report 1) Choose a protein that you are interested in purifying. -This can be any protein (there are millions possible so no two students would by chance choose the same protein) - You can use resources like NCBI (https://www.ncbi.nlm.nih.gov/protein/ ) or KEGG (https://www.genome.jp/kegg/pathway.html), among others to find a protein you are interested in making. **(List the name of the protein you plan to make and the organism it comes from) 2) Find the amino acid sequence of that protein and then find the DNA sequence needed to make that amino acid sequence. -The amino acid sequence may be found at the links above. DNA sequences may be found at NCBI or KEGG as well or deduce it here: https://en.vectorbuilder.com/tool/codon-optimization.html **(List the amino acid sequence and its corresponding DNA sequence for this protein you plan to make) 3) Choose a set of restriction enzyme that you can use to cut your pET14p expression vector but that will not cut the important protein coding regions of the gene you are inserting into pET14p -NOTE: You should make sure that the coding sequence of your selected protein you choose does not already contain the sequences recognized by those restriction enzymes you selected to cut your pET14p vector or else it will cut your gene at a place you don't want. You can use this tool http://nc2.neb.com/NEBcutter2/ to check if your gene (DNA sequence that codes for your protein of interest when translated) contains the sequences recognized by that restriction enzyme that you have chosen. If the gene does contain a sequence that will be cut by your enzymes selected to cut the pET14p vector then you'll either have to choose a different enzyme or select a different codon for those positions on that gene so that it can make the same protein but not be cut improperly by the restriction enzymes you plan to use. Because you will be expressing your protein for purification using Nickel affinity chromatography, make sure that your choice of cutting location does not remove the HisTag sequence from your vector. **(List the names of the restriction enzymes you will use to cut the pET14p vector and their recognition sites. Also show where in the pET14p vector that it cuts) 4) Imagine you have access to the DNA template of this gene. Choose the appropriate forward primer and reverse primer that you will need to PCR this gene from your template. Make sure that your primers have 5' ends that possess the corresponding restriction sites needed to later insert the PCR product into your pET14p vector. - NOTE: You will need your primers to have approximately the same melting temperature (within 2 degrees of each other) and they should be between 55°C to 65°C. You may find this tool useful http://www.biophp.org/minitools/melting_temperature/demo.php (you can select basic Tm). Remember that your reverse primer sequence would be the reverse complement of the gene sequence you had chosen (if you are looking at the coding sequence in the proper way) and as such you may find the following tool useful for getting the reverse complement: http://www.bioinformatics.org/sms/rev_comp.html **(Provide the forward and reverse primer DNA sequences from 5' to 3' and their expected melting temperature...underline the restriction sites on each primer) 5) Show your plasmid containing the recombinant DNA for your gene. Imagine that you have now conducted the PCR successfully with your primers on your gene of interest to get a PCR product and that you have cut the PCR product using the same restriction enzymes from step 3 that you used to cut the vector. After ligating the cut PCR product into the cut pET14p vector you will have a complete plasmid. **(Show what the DNA sequence will look like for the ligated DNA of your final complete plasmid but just show the region between the T7 promoter and T7 terminator after you have ligated your gene into the vector making sure to underline the restriction sites and placing in bold (or highlight in yellow) the new sequence of your gene that you inserted into the vector) 6) Assume you have now transformed E. coli with this complete plasmid DNA including your gene and it worked to make the protein that you wanted. Show the protein sequence of your final product that would result from expression of this plasmid. **(Show the translated DNA sequence from step 5 so please show the amino acid sequence of what your expressed protein would be. Remember that it will need to included the His-tag in the same frame so you must check if your open reading frame makes sense. You can use an online translation tool like: https://web.expasy.org/translate/. Show what the amino acid sequence will look like if you were to express this protein by translating the region between the first Methionine after the Ribosome Binding Site until you reach the first stop codon). If you do see a stop codon prior to that then your reading frame is likely mis-aligned and you will nee to re-adjust your forward PCR primer to either include an additional nucleotide or two nucleotides to get your insert it into the correct reading frame with the rest of your pET 14p vector. This additional nucleotide (or two) can be placed between the restriction site and the start of your gene when designing your forward primer. PET-14p sequence landmarks T7 promoter T7 transcription start His Tag coding sequence Multiple cloning sites (KpnI - Spe I) T7 terminator pBR322 origin bla coding sequence 646-662 645 554-571 510-526 404-450 Sca (4156) 2845 Pvu I(4046) 3606-4463 Pst I(3921) Eam1105 I(3676). HgiE II(3369) AlwN I(3199) Aat II(4598) Ssp I(4480) EcoR I(4669) Apo I(4669) Cla I(24) Hind III(29) <j「3606-4463) ori (2845) Bpu1102 I(458) Nhe I(229) Kpn I (510) Ball (515) Spel (522) Nco I(580) Xba I(619) Bgl II(677) SgrA I(718) Sph 1(874) EcoN I(934) -Sal I(959) PshA I(1024) PET-14P (4671bp) Eag I(1247) Nru I(1282) ApaB I(1360) BspLU11 I(2783) Afl III(2783) Sap I(2667) Bst1107 I(2554) BsaA I(2535) Tth111 I(2528) BsmB I(2424) Pvu Il(2374) BspM I(1362) Bsm I(1667) Msc I(1754) Bpu10 I(1889) Bsg I(1943) PET 14p Nhe I(229) BglII T7 promoter primer #69348-3 T7 promoter Bpu1102 I(458) Kpn I (510) Ball (515) Spel (522) Nco I(580) Xba I(619) Bgl II(677) SgrA I(718) XbaI You can check the sequence recognized by the restriction sites by searching the names of the enzymes on http://www.neb.com/ rbs means the ribosome binding site ▶rbs AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAAC GGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA NcoI His Tag Spe I Ball KpnI TATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCC TGGTGCCGCGCGGCAGCACTAGTGGCCAGGTACCGGCTGC TAAC AAAGCCCGA MetGlySerSerHisHisHisHisHisHisSerSerGlyLeuVal ProArgGlySerThrSerGlyGInVal ProA laAlaAsnLysAlaArg Bpu1102 I thrombin T7 terminator AAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTC TAAACGGGTCTTGAGGGGTTTTTTG LysGluAlaGluLeuAlaAlaAlaThгAlaGluGInEnd T7 terminator primer #69337-3 Same as above but text can be copied for your convenience: AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA TATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCACTAGTGGCCAGGTACCGGCTGCTAACAAAGCCCGA AAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGSee Answer
  • Q10:3. The following metabolic pathway exists in a strain of bacteria. The bacteria require product D to survive. The three enzymes required to produce D are controlled by three separate genes (genes 1 to 3). A enzyme 1 B enzyme 2° C enzyme 3*D Assume that this pathway is under the control of an operon. a) In the space provided below, draw the operon for this biochemical pathway. [2 A] b)Illustrate a scenario when the levels of D are HIGH (i.e. the bacteria would not require the enzymes to produce D) [2 A] 4. The gel below, was produced by DNA sequencing. What was the original DNA template strand sequence? [4T] ddCTP ddGTP ddTTP ddATP | | |/n5. During an investigation of the promoter region of a gene you apply heat to two sections of DNA that you believe could be a promoter region. One region unwinds at 80 degrees Celsius and the other unwinds around 60 degrees Celsius. Which of the two strands contains the promoter? Explain. [4 T] 6. Use labelled diagrams incorporating the concept of the "Central Dogma of Molecular Genetics" to illustrate how a mutation can lead to disease. [4 C]See Answer
  • Q11:Inflammation is one of the crucial processes of innate immunity that alerts the immune system and recruits the needed cells, clears the damaged area, and then sets the stage for subsequent tissue repair or regeneration. Despite the importance of inflammation to immunity and the role of chronic inflammation in many common pathologies, we have only begun to gain a basic understanding of the major events that initiate, regulate, and inhibit the process. Although we have known that neutrophils are among the first cells to arrive on the scene of an inflammatory response, we have only recently begun to understand the important role that these cells play in the process. It was discovered in the mid-2000s that neutrophils form structures dubbed neutrophil extracellular traps, or NETS, when activated in an inflammatory response. Briefly, what are NETS, what is in them, and what purpose do they serve in inflammation and immunity? What are a few of the major pathologies that NETs have been implicated in?See Answer
  • Q12:/n 2/9/24, 2:52 PM https://nerd.wwnorton.com/nerd/122222/r/goto/cfi/158!/4 Deep in the DNA Deep in the DNA Each day in the United States, on average 22 people die while waiting for an organ transplant. Over 113,000 men, women, and children are currently on the national transplant waiting list, each hoping their name is called before it's too late. Researchers have explored many ways to grow and store organs for transplantation-from freezing them to building them from scratch-but one of the most promising, if you can look past the mud and flies, is pigs. Our porcine friends have long been considered an excellent potential source of organs because their organs-including the heart, liver, and kidneys-are relatively close in size to human organs and because pigs and humans have similar anatomies (Figure 9.2). In addition, pigs are an easier sell to the public: people tend to prefer the idea of transplants from pigs over transplants from mammals more closely related to us, such as baboons. If we were able to transplant organs from nonhuman animals into humans, a process called xenotransplantation, healthy organs could be available in essentially limitless supply. Kidney Pancreas Liver Heart Lung Figure 9.2 Pig organs and human organs are remarkably similar in size For a nonhuman-to-human organ transplant to succeed, the nonhuman organ must fit into the space where the human organ was removed. Organs that are too big will not fit. Organs that are too small will not function at the level necessary to sustain life. 1/4 2/9/24, 2:52 PM https://nerd.wwnorton.com/nerd/122222/r/goto/cfi/158!/4 Deep in the DNA Yet there has been a barrier to harvesting pig organs for humans: the pig genome is dotted with DNA from a family of viruses called porcine endogenous retroviruses, or PERVS. Because of the presence of this viral DNA in the pig genome, pig cells produce and release PERVS-and two of the three subtypes of PERVS can infect human cells, making it risky to transplant pig organs into people for fear of making the recipients sick. After pigs acquired the viruses, PERV DNA slipped easily into the pig genome because it has the same structure as pig DNA. In fact, all living things share the same DNA structure, and species often share and swap DNA with each other. As discussed in Chapters 3-4, DNA is built from two parallel strands of repeating units called nucleotides. Each nucleotide is composed of the sugar deoxyribose, a phosphate group, and one of four bases: adenine, cytosine, guanine, or thymine. We identify nucleotides by their bases, using "adenine nucleotide" as shorthand for "nucleotide with an adenine base." The nucleotides of a single strand are connected by covalent bonds between the phosphate group of one nucleotide and the sugar of the next nucleotide. The two DNA strands are connected by hydrogen bonds linking the bases on one strand to the bases on the other, like the rungs that connect the two sides of a ladder (Figure 9.3). Covalent bonds are strong, which is important in maintaining the specific order of the nucleotides. The weaker hydrogen bonds allow the two DNA strands to be pulled apart for replication. A pairs only with T The nucleotides in one strand are paired with the nucleotides in the complementary strand. C pairs only with G. The two strands of DNA are held together by hydrogen bonds (dotted lines) between the bases. Nucleotides are linked together by covalent bonds to form one strand of DNA. Q1: Name two base pairs. SHOW ANSWER 0000 SHOW ANSWER Phosphate Sugar (deoxyribose) Sugar-phosphate Base Nucleotide Nucleotide bases: Adenine Figure 9.3 A molecule of DNA consists of two complementary strands of nucleotides that are twisted into a spiral around an imaginary axis, rather like the winding of a spiral staircase. Thymine Guanine Cytosine Q2: Why is the DNA structure referred to as a "ladder"? What part of the DNA represents the rungs of the ladder? What part represents the sides? Q3: Is the hydrogen bond that holds the base pairs together a strong or weak chemical bond? Why is that important? 2/4 2/9/24, 2:52 PM https://nerd.wwnorton.com/nerd/122222/r/goto/cfi/158!/4 SHOW ANSWER Deep in the DNA You can also see Appendix A for answers to the figure questions. The term base pair, or nucleotide pair, refers to two nucleotides held together by bonds between their bases; that is, a base pair corresponds to one rung of the DNA ladder. The ladder twists into a spiral called a double helix (Figure 9.4). Within the long, winding double helix of the pig genome, short sections of DNA from PERVS are scattered about. These PERV sections are made up of the same four nucleotides as the rest of the DNA, but they encode information for viral proteins instead of pig proteins. Figure 9.4 What DNA actually looks like In November 2012, Italian researchers used an electron microscope to directly visualize DNA for the first time. This is the single thread of double-stranded DNA that they saw. Nucleotides do not form base pairs willy-nilly. As shown in Figure 9.3, the adenine (A) nucleotide on one strand can pair only with thymine (T) on the other strand; cytosine (C) on one strand can pair only with guanine (G) on the other strand. These base-pairing rules, which provide complementary base-pairing between two nucleic acid strands, have an important consequence: when the sequence of nucleotides on one strand of the DNA molecule is known, the sequence of nucleotides on the other, complementary strand of the molecule is automatically known as well. The fact that A can pair only with T and that C can pair only with G allows the original strands to serve as "template strands" on which new strands can be built through complementary base-pairing. (In Chapter 10, we delve more deeply into building new DNA strands, including how RNA can pair with DNA, which CRISPR takes advantage of.) Still, the four nucleotides can be arranged in any order along a single strand of DNA, and each DNA strand is composed of millions of these nucleotides, so a tremendous amount of information can be stored in a DNA sequence and in a genome. The genome of the domestic pig, for example, has about 3 billion base pairs, the human genome has about 3.2 billion base pairs, a tomato has only about 900 million base pairs, and the bacterium Escherichia coli (better known as E. coli) has a measly 4.6 million. The sequence of 3/4 2/9/24, 2:52 PM https://nerd.wwnorton.com/nerd/122222/r/goto/cfi/158!/4 Deep in the DNA nucleotides in DNA differs among species and among individuals within a species, and these differences in genotype can result in different phenotypes (Figure 9.5). MIN G A C SHOW ANSWER A Human A Figure 9.5 The sequence of bases in DNA differs among species and among individuals within a species The sequence of bases in a hypothetical gene is compared for two humans (A and B) and a pig. Base pairs highlighted in blue are variant; that is, they differ between the genes of persons A and B and between the same genes in humans and pigs. SHOW ANSWER Human B Q1: If all genes are composed of just four nucleotides, how can different genes carry different types of information? Pig SHOW ANSWER Q2: Would you expect to see more variation in the sequence of DNA bases between two members of the same species (such as humans) or between two individuals of different species (for example, humans and pigs)? Explain your reasoning. Q3: Do different alleles of a gene have the same DNA sequence or different DNA sequences? You can also see Appendix A for answers to the figure questions. In the mid-1990s, scientists became very excited about the idea of using pig organs in humans, but testing stalled because of the fear that humans would become infected with PERVS. Just breeding pigs in sterile conditions can't get rid of the virus; it's integrated right there in the double helix. The Harvard Medical School team believed CRISPR might be able to solve that problem by inactivating the PERV DNA in pig cells once and for all. 4/4See Answer
  • Q13:2. What is the difference between a nucleoside triphosphate and a trinucleotide?See Answer
  • Q14:6. Using the pK₂ data in Table 4.1 and the Henderson-Hasselbalch equation, calculate the approximate net charge on each of a the four common ribonucleoside 5'-monophosphates (rNMPs) at pH 3.8. If a mixture of these rNMPs was placed in an electrophoresis apparatus, as shown, draw four bands to predict the direction and relative migration rate of each. Application zone +See Answer
  • Q15:Where in the cell would transcription occur? ○ ) nucleus ○ ) ribosome ○ ) cytoplasm ○ ) mRNASee Answer
  • Q16:If a cell were to replicate (mitosis), what would you expect the replicated strand to look like? ○ ) TAC CGC UAA GGG CAC ○ ) TAC GCG UAA GGG CUG O) UAC GCG UAA GGG CUG ○ ) TAC GCG TAA GGG CTGSee Answer
  • Q17:on Based on this information, what would you expect the mRNA be during transcription? ○ ) UAC GCG TAA GGG CTG O) UAC GCG UAA GGG CUG O) UAC CGC TAA CCC GTC ○ ) AUC GCG ATT GGG CUGSee Answer
  • Q18:What role would tRNA play during the process of protein synthesis? O) brings the amino acid to mRNA ○ ) directs the mRNA to the ribosome O) Is part of the ribosome O) zips DNA back upSee Answer
  • Q19: Part I: General questions. Please pick 3 and write a short essay (no more than 350 words) about each. Please include drawings, if appropriate. Remember that compare and contrast means: tell me what they have in common, and what their key differences are. 2. Please compare and contrast transcription in prokaryotes and eukaryotes 3. Please discuss the ways in which gene expression can be controlled post- transcriptionally 6. Please discuss why mangroves are worth studying. What makes them unusual? What sorts of genes might be expressed differently when grown in fresh and salt water? How might mangroves benefit humans? Part II: More specific questions. Please pick 3 and write a short essay about each. Please include drawings, if appropriate. 1. Please compare the various classes of cloning vectors and discuss their uses. 4. Please describe initiation of transcription by RNA polymerase 2 and why it is so much more complex than other RNA polymerases. 6. Please compare and contrast translation in prokaryotes and eukaryotes.See Answer
  • Q20: 1. What is a receptor and why do viruses interact with receptors? B) View the data in Figure 1 below and then answer Questions 2-7 below: Figure 1: Effect of an antimicrobial peptide (AMP) on virus infection. A) Sequence of the original antimicrobial peptide (AMP37) and two peptides in which specific amino acids were mutated to either glycine (GG-48) or A) AMP37 LLGDFFKPSILKWARMWINTERSWEATERPRTESSKL GG-48 WW-48 GILKWARMWINTERSWEATERGR WILKWARMWINTERSWEATERWR +Virus Mock No Peptide AMP37 GG-48 ww-48 000 00 0.01 μM 0.1 μM 1 μM 2. What is the objective of this experiment? 3. In this experiment, what is crystal violet staining? tryptophan (WW-48). Mutated amino acids are shown in red. B) Monkey kidney (Vero) cells were incubated without or with different concentrations of AMP37, GG-48 and WW- 48 for 2 hours before infection with virus. At the time of infection cells -/+ peptide were incubated withphosphate buffered saline (PBS; mock-infection) or with virus. After 1 hour, the virus and peptide were removed, and fresh media -/+ peptide was added onto the cells. 12 Hours later, the media was removed, the cells were fixed with 3.4% formaldehyde and the stained with crystal violet. Relative levels of viral RNA 4. Why is the well of the mock infected cells purple but there is no color in the well that was incubated with virus and no peptide?) 5. Rank the antimicrobial peptides in the order of potency. 6. Explain your ranking from Question 5. 7. What do you think these peptides are targeting (the virus or the cell)? Explain your answer. View the data in Figure 2 below and then answer Questions 8-11 below: Figure 2: Effect of an antimicrobial peptide (AMP) on virus infection. 500- 400- 300- 200- 100- O Mock GG-48 WW-48 *** *** T 6 8 10 12(h.p.i) Monkey kidney (Vero) cells were incubated without or with different GG-48 and WW-48 for 2 hours before infection withvirus. At the time of infection cells -/+ peptide were incubated with phosphate buffered saline (PBS; mock-infection) or with a single-stranded positive-sense RNA virus. After 1 hour, the virus and peptide were removed and fresh media -/+ peptide was added onto the cells. At 1-, 2-, 4-, 6-, 8-, 10- and 12-hours post- infection cells were collected and the amount of virus in the cells was quantified by RT-PCR that measured levels of viral RNA and cellular GAPDH mRNA. Statistical significance was determined by student t-test when comparing mock-infection versus treatment with the antimicrobial peptides. ***P<0.0001 8. Provide a brief description of the infectious cycle of a single-stranded positive sense RNA virus from the of entry into the cell to exist. 9. In Figure 2, how are the researchers measuring infection? 10. Describe the data presented in Figure 2 in detail. 11. At what step in the infectious cycle do you think the GG-48 and WW-49 peptides are acting to restrict virus infection? Explain your answer. Virus G protein 12. What is the mechanism used by enveloped viruses to transverse a cellular membrane and enter the cell? 13. What viral protein is used for this process? 14. Draw a schematic or describe the important features of this viral protein? View the data in Figure 3 below and then answer Questions 15-19 below: + Control plasmid + ADAM17 + Furin + Cathepsin K Figure 3: Vero cells were co-transfected with a plasmid expressing the glycoprotein (G) found on the surface of Lexo Virus (LexoV), an envelope virus, and different cellular enzymes (ADAM17, Furin and Cathepsin K). Membrane fusion was examined by the formation of syncytia or multinucleated cells 24 hours post-transfection. Arrows show syncytia. 15. Describe the data in Figure 3. 16. Does the LexoV glycoprotein require a cellular cofactor for membrane fusion? Explain your answer. 17. Where in the cell are ADAM17, furin and cathepsin K localized? 18. The LexoV G protein is synthesized as a precusor potein (G0) which is then proteolytically cleaved to G1 and G2. G1 interacts with the cellular receptor and G2 mediates membrane fusion. Knowing the subcellular location of ADAM17, furin and Cathepsin K, where in the cell is G0 likely proteolytically cleaved. 19. At which cellular membrane does the G2 protein promote membrane fusion and entry LexoV? Explain your answer. A) Use Figure 4 below to answer Questions 20-25: B) LexoV-PWT LexoV-P ΔΑΒ 4.5 5 5.5 6 6.5 7 11 4.5 5 5.5 6 6.5 7 h.p.t. 11 Band intensity (normalized to maximal intensity) 1.0- 0.5- → LexoV-PWT ...LexoV-PAAB Time post-transfection (h) Ţ LexoV is a single-stranded negative-sense RNA virus that encodes N, P, M, and L proteins. Use your knowledge of the VSV replication mechanisms to help answer the questions below. 20. Which viral proteins are required for replication of LexoV? Describe the function of each of these proteins. Figure 4: The goal of this experiment was to investigate the role of an unusual domain (AB) within the LexoV P protein. In this experiment, vero cells were infected with LexoV containing either the wildtype P protein (LexoV-Pwr) or a virus in which the AB domain within P was deleted. (LexoV-PAB). At 2 hours post-infection, the normal media was removed and replaced with phosphate-deficient media, [g-23P]ATP and actinomycinD. Cells were harvested every 30 minutes from 4.5-7 hours post-infection. Total cellular and viral RNA was isolated and separated in an agarose gel, dried and exposed to a phosphorimager screen to detect the amount of newly synthesized viral RNA. A) A representataive image of the viral RNA synthesized. B) Quantification of the viral RNA at each time point. * denotes the newly synthesized viral RNA. 21. Describe the overall strategy used by single-stranded negative-sense RNA viruses to replicate the viral genomes. 22. Describe the data shown in Figure 4A. 23. Describe the data shown in Figure 4B. 24. What conclusion can be drawn from Figure 4. 25. Speculate on the function of the AB domain within the P protein. Explain the rationale for your answer.See Answer

TutorBin Testimonials

I found TutorBin Molecular Biology homework help when I was struggling with complex concepts. Experts provided step-wise explanations and examples to help me understand concepts clearly.

Rick Jordon

5

TutorBin experts resolve your doubts without making you wait for long. Their experts are responsive & available 24/7 whenever you need Molecular Biology subject guidance.

Andrea Jacobs

5

I trust TutorBin for assisting me in completing Molecular Biology assignments with quality and 100% accuracy. Experts are polite, listen to my problems, and have extensive experience in their domain.

Lilian King

5

I got my Molecular Biology homework done on time. My assignment is proofread and edited by professionals. Got zero plagiarism as experts developed my assignment from scratch. Feel relieved and super excited.

Joey Dip

5

TutorBin helping students around the globe

TutorBin believes that distance should never be a barrier to learning. Over 500000+ orders and 100000+ happy customers explain TutorBin has become the name that keeps learning fun in the UK, USA, Canada, Australia, Singapore, and UAE.