bioinformatics homework help

Boost your journey with 24/7 access to skilled experts, offering unmatched bioinformatics homework help

Trusted by 1.1 M+ Happy Students

4.3Trust Pilot

4.4Edu Reviewer

4.5App Review

4.5Student

WhatsApp Support

Get Instant
Online Homework Help
via WhatsApp

Get instant homework help from top tutors—just a WhatsApp message away. 24/7 hw help support for all your academic needs!

★★★★★

2M+ students trust TutorBin

Your WhatsApp Number

⚡ Instant reply

🔒 100% private

👨‍🏫 Top tutors

🌍 All subjects

^*Get instant homework help from top tutors—just a WhatsApp message away. 24/7 support for all your academic needs!

2M+ Students Helped24/7 Live SupportExpert TutorsAll Subjects CoveredInstant Response100% ConfidentialTop Rated ServiceMoney-back Guarantee2M+ Students Helped24/7 Live SupportExpert TutorsAll Subjects CoveredInstant Response100% ConfidentialTop Rated ServiceMoney-back Guarantee

Recently Asked bioinformatics Questions

Expert help when you need it

Q1:B. Briefly describe Ensembl: what it is, what information it holds, and which other entities are like it See Answer
Q2:Recombinant DNA You have received a PCR product from an unknown organism that caused fever and a strange rash in young child. The family of the child has two kittens, and the physician treating the child suspects an infection with Bartonella. Strangely, the growth characteristics do not match those of known Bartonella species. The clinical lab has amplified an 825 base pair fragment of the unknown organism's genome and has asked you to use the PCR product to investigate the identity of the unknown bacteria. Once you received the DNA you decided to have the PCR product sent out for sequencing. Bioinformatics 1) Using a Blastn search determine the top 3 most similar DNA sequences and using Blastx determine the top 3 most similar proteins. What gene did the clinical lab PCR amplify? • What is the function of the protein? • Based on the results from this gene what organism did you isolated? And what species is your organism most similar to?See Answer
Q3:PCR/Primer Design and Cloning Now that you have learned a little bit about the genetics of the unknown organism you have been asked to create a real-time PCR assay to detect the unknown in other patient's blood samples using the gene that was amplified by the clinical lab. To create your standards for your real-time PCR assay you need to clone your DNA fragment into a plasmid (pUC19) using standard PCR techniques. 2) Using the 825 bp sequence for your unknown fragment, please create a primer pair that will amplify a 500 base pair fragment of the gene. Additionally, please add restriction sites to the ends of your primers. Please provide the following: • Sequences of the primers • Primer Tm • The location of the primers in the sequence • The restriction sites you used. Remember: Check to make sure that the restriction sites will only cut the primers and are not found anywhere else in the DNA sequence but are found in pUC19.See Answer
Q4:Part 1: Smith-Waterman Algorithm Instructions: 1. Copy the "STS protein query sequence" from the week 3 links page (This is the one letter code for the protein encoded by the Resveratrol synthase gene, the gene that catalyzes the final step in the resveratrol synthesis pathway). Be sure to include the ">STS query" on the first line, or the program won't accept it. 2. Go to https://www.ebi.ac.uk/Tools/sss/ and choose SSEARCH, then "protein". This will do a Smith-Waterman local alignment on your protein sequence. 3. Choose the UniProtKB/TrEMBL database (under Step 1 on the page) 4. Paste the STS protein query sequence into the paste window 5. Choose SSEARCH under step 3, then click "More options". Here you will find a number of parameters including the substitution matrix. Search UniProt using three different substitution matrices: • BLOSUM 50 • PAM 120 • PAM 250 Be patient, the calculation will take a while. Questions: 1. What is the name and score of the best hit for each matrix? 2. What is the e-value of the best hit for each matrix? 3. Why do you think the results may have changed? 4. What do e-values mean and how do we interpret them?See Answer
Q5:Part II: Needleman-Wunsch Algorithm Instructions: 1. Go to https://www.ebi.ac.uk/Tools/sss/ and select GGSEARCH then protein. This will do a Needleman-Wunsch global alignment on your protein sequence. 2. Choose UniProtKB/TrEMBL as your database (step 1) 3. Paste in your STS protein query sequence (step 2) 4. Click More options... on step 3 and choose BLOSUM50 as your scoring matrix and then click Submit. Questions: 1. What is the name and score of your top hit? 2. How do these results differ from what you got with the Smith-Waterman algorithm (SSEARCH)? 3. Why do you think the results differed?See Answer
Q6:Part III: FASTA Algorithm Instructions: 1. Go to https://www.ebi.ac.uk/Tools/sss/ and select FASTA, then protein. 2. Choose UniProtKB/TrEMBL as your database (step 1) 3. Paste in your STS protein query sequence (step 2) 4. Click More options... on step 3 and run your queries for the following choices of parameters: Scoring Matrix BLOSUM 50 BLOSUM 80 BLOSUM 80 BLOSUM 80 Gap Open -10 -10 0 -64 Gap Extend -2 -2 0 -16/nQuestions: 1. Did these calculations take as long as the Smith-Waterman search? If so, why? 2. Were the results different from the Smith-Waterman search? Why do you think this happens? 3. What is the effect of changing to a higher cutoff BLOSUM matrix (i.e. from 50 to 80) and what does it mean? 4. What is the effect of changing the Gap Open and Gap Extend parameters? Why do you think you observed what you did?See Answer
Q7:Part IV: using BLAST Instructions: 1. Go to http://blast.ncbi.nlm.nih.gov/Blast.cgi 2. Click on nucleotide BLAST. 3. Copy STS mRNA query sequence from the week 3 links page then paste it into the Query sequence window (note that this is a nucleotide sequence). 4. Under Database, choose Standard databases 5. Choose optimize for somewhat similar sequences (blastn) under Program selection, (note this is not the default) then click BLAST. 6. Now, run the same query against the expressed sequence tags database (est). (Database "Others", then scroll to "expressed sequence tags") Questions: 1. What are the names, scores, and e-values of your best hits for the two different searches you just performed? 2. Why are these results so different?See Answer
Q8:Part V: Comparing FASTA and BLAST and SSEARCH Instructions: 1. Go to https://www.ebi.ac.uk/Tools/sss/ 2. You will do a nucleotide search using the STS mRNA from the previous step using FASTA, BLAST, and SSEARCH. 3. Leave the database as the default setting. 4. Select FASTA as your program, select more options, and set the following parameters: 5. Match/Mismatch: +3/-2 6. Gap Open: -5 7. Gap Extend: -2 8. Run the search and note the name, score, and e-value of the best hit. 9. Repeat this for BLAST and SSEARCH. Questions: 1. What were your best hits for each of the different search algorithms? 2. Were they different and if so why? 3. Why was it necessary to set the parameters as described above before running the searches?See Answer
Q9:Part I: Learning about molecular phylogenies 1. What is the basic assumption underlying a molecular phylogeny? Why must we distinguish between gene trees and species trees? 2. 3. Why don't genes always evolve by a series of bifurcations (i.e., by a series of single base changes)? 4. What are the four steps to constructing a molecular phylogeny? 5. What is an orthologous sequence? 6. What is a paralogous sequence? 7. What is a xenologous sequence? 8. Which type of sequences should you use for a species phylogeny? 9. What is the difference between multiple sequence alignments to discover motifs, etc., vs for constructing phylogenies? 10. Why is Clustal W not a very good choice for constructing species phylogenies?/n10. Why is Clustal W not a very good choice for constructing species phylogenies? 11. Please use the supplemental material on the links page to answer the following questions. What is a phylogenetic tree composed of? What is the difference between rooted and unrooted phylogenetic trees? What are the two major groups of analyses used to examine phylogenetic relationships? 0 0 0 What is a paraphyletic grouping? What happens if a multiple alignment is poor? What is the best way to deal with parts of an alignment that are uncertain due to gaps? What sorts of phylogenies are best constructed using DNA sequence alignments? What sorts of phylogenies are best constructed using protein alignments? What sorts of phylogenies are best constructed using ribosomal RNA sequence alignments? 0 0 0 0 0 What is a homoplasy? 0 Why can't we simply construct all possible trees, score each one, then pick the one with the best score? 0See Answer
Q10:Part II: Distance matrix methods 1. Answer the following questions: What is the general approach used by distance matrix methods to construct a phylogeny? a. b. 2. 3. 4. a. 5. a. b. 6. What are the main differences between UPGMA and neighbor-joining methods? Take your protein sequences from the links page and import them into Mega. Align them via Clustal W and save the alignment. Use your alignment to construct UGMA and Neighbor-Joining Trees. What are the differences and similarities between the trees? Repeat the above with an alignment based on MUSCLE instead of ClustalW. How does this change the results? Why do you think the results are different? Include labeled screen shots of your different trees.See Answer
Q11:Part III: Maximum parsimony methods 1. 2. 3. 4. What is the key assumption of maximum parsimony methods? How does this differ from distance matrix methods? What are the advantages of maximum parsimony methods? What are the disadvantages of maximum parsimony methods?See Answer
Q12:Part V: Tree evaluation 1. 2. 3. 4. 5. What are the three basic ways to resample the data for tree-building? What is jackknife resampling? What is bootstrap resampling? How does it differ from jackknife resampling? Recreate one of your ML trees except use Bootstrap Resampling as a method of tree evaluation. 6. How did your tree change?See Answer
Q13:3. RNAFold also uses partition-function methods (AKA thermodynamic ensemble methods). What is a partition function and how is it related to free energy? What are the advantages and disadvantages of calculating partition functions?See Answer
Q14:1. For BLAST/FASTA tell us how many significant results were found, and which sequences were most closely related and who they came from. Identify and try to explain any unexpected similarities and any differences between the searches using DNA versus amino acid sequences.See Answer
Q15:3. For PSI-BLAST etc tell us how many more distant relatives were found, what sorts of organisms they came from, and what sorts of proteins were related. Identify and try to explain any unexpected results.See Answer
Q16:4. For VAST (or the other structural alignment programs) tell us what sorts of proteins you found, and whether you found any new ones missed by the sequence-based approaches. Discuss any differences from the sequence-based approaches, and dentifySee Answer
Q17:5. For Clustal W describe the relationships that were identified, and what parts of the protein were related. Identify and try to explain any unexpected results.See Answer
Q18:Note: Calculate RF for all populations with two linked OR unlinked genes. Population Name: Practice population 1 Trait 1 - Dominant/Recessive - Yes/No Dominant form: Trait 2- Dominant/Recessive - Yes/No (Supporting Cross = Vial Location of gene: Autosome X Chromosome (Supporting Cross = Vial Dominant form: Location of gene: Autosome Codominant - Yes/No Recessive form: Codominant - Yes/No Recessive form: Are the two genes linked? Yes/No Recombination frequency between genes: Codominant form: Codominant form: (Supporting Cross = Vial X Chromosome (Supporting Cross Vial (Supporting Cross = Vial (Supporting Cross = VialSee Answer
Q19: Introduction to Biotechnology 2024 LAB 5 Worksheet DNA is a long polymer of four distinct nucleotides, which exists as a double stranded helical molecule. The four nucleotides are abbreviated as A, C, G, T. Their sequence in double-stranded DNA varies as it goes along. Occasionally, and purely by chance, there occurs in the DNA what are called palindromic sequences of nucleotides. These are symmetrical sequences, which read the same forward as they do backward on the opposite strand of DNA. Two examples of these palindromic sequences are highlighted in the sequence below. TTAGAAGCTTTTATCCGTAAAAGAATTCCTTTCAGAAACGCGGAT..etc AATCTTCGAAAATAGGCATTTTCTTAAGGAAAGTCTTTGCGCCTA..etc In bacteria, palindromic sequences are recognized by specific enzymes whose purpose in nature is usually to destroy DNA. These enzymes are called endonucleases. Each restriction enzyme has a highly specific shape, so it can only stick to certain sequences of letters in the DNA code. This is called a "recognition sequence” or "restriction site”. If its "recognition sequence" is present, the enzyme will be able to Bind to the recognition sequence on each of the DNA strands and cut the DNA in a very specific way. For example, when EcoRI recognizes and cuts this site, it always does so in a very specific pattern that produces ends with single-stranded DNA “overhangs” (Figure 1): AATTC 5' 3' GAATTC CTTAAG 3' 5' S' 3' G G CTTAA EcoRI enzyme Figure 1 EcoRI restriction pattern Page 1 of 5 mis 3' 5' Introduction to Biotechnology 2024 Exercise 1: (a) Study the DNA sequence below carefully. It's a length of linear double-stranded DNA (both strands are shown). Find and indicate on the sequence where the restriction endonuclease EcoRI will cut the DNA (i.e. search the DNA for the palindromic sequence required for recognition by the enzyme EcoRI). The hyphen means that the DNA continues onto the next line. TTAGAAGCTTTTATCCGTAATAAGGAATTCCTTTCAGAAACGCGGATACCCCCGTA- AATCTTCGAAAATAGGCATTATTCCTTAAGGAAAGTCTTTGCGCCTATGGGGGCAT- TTATCCGTAAATGGATTTCAGAAACGCGGATACCAATTCCGAGAAATAAAGGCCCG- AATAGGCATTTACCTAAAGTCTTTGCGCCTATGGTTAAGGCTCTTTATTTCCGGGC- ATACTTATCCGTATAAAGGATTCCAGAACGCGGATACCAATTCCGAATTCATAAAG- TATGAATAGGCATATTTCCTAAGGTCTTGCGCCTATGGTTAAGGCTTAAGTATTTC- TATTAGGCTGCTAGCTAGCGCTAGATCGCAGTCGTAGCTAGTCGTAGCGCGCGTAT- ATAATCCGACGATCGATCGCGATCTAGCGTCAGCATCGATCAGCATCGCGCGCATA- ACGCGGATACCAATTCCGAATTCATAAAGAGTCGTAGCTAGTCGTAGCGCGCGAAA TGCGCCTATGGTTAAGGCTTAAGTATTTCTCAGCATCGATCAGCATCGCGCGCTTT (b) How many times does the EcoRI site occur in the sequence above? (c) If the DNA sequence above was treated with EcoRI, how many fragments of DNA will result? (d) How long will each resulting fragment of DNA be after cutting with EcoRI? Count the bases pairs in each. (Note: a base pair is two bases bonded to one another) Page 2 of 5 Introduction to Biotechnology 2024 (e) Indicate in the gel below the pattern of DNA fragments which you would see after the digest was run on an electrophoresis gel. Indicate the size (bp) of each of the fragments Direction of electrophoresis Exercise 2: The restriction enzymes EcoRI, HindIII and BamHI were used to cut lambda DNA. The restriction site for each enzyme is shown here, indicated by the arrow. EcoRI 5....GAATTC.....3' 3.....CTTAA G......5 1 ↓ HindIII 5.A AGCTT....3° 3....TTCGA A...5' ↑ BamHI 5...G GATCC.....3° 3.....CCTAG G.....5 Page 3 of 5 Introduction to Biotechnology 2024 21226 7421 23130 9416 6557 bp 16841 4361" 7233 3383 6770 6627 6626,5506 ||| 0.7% agarose 5804 5643 4878 3530 1.0% agarose 564 125 1% agarose EcoRI HindIII BamHI Figure 2 Expected restriction patterns of lambda DNA cut with various restriction enzymes Figure 2 above shows the size of each of the fragments/bands produced when lambda DNA is cut with each of these restriction enzymes. The sizes were determined by comparison to a molecular ladder. Figure 3 below represents complete lambda DNA sequence and indicates the total number of base pairs (bp) it contains (48502 bp). Samples labelled A, B and C represent lambda DNA cut with one of the three restriction enzymes (EcoRI, HindIII and BamHI) where the lines indicate the DNA being cut by the enzyme. Use these diagrams to answer the following questions. ADNA 0 10,000 20,000 30,000 40,000 48,502 (bp) A 5505 22,346 27,972 34,499 41,732 (bp) 1 B 21,226 26,104 31,747 39,168 44,972 (bp) C 23,130 27,479 36,895 37,584 44,141 25,157 37,459 (bp) Figure 3 Complete lambda DNA sequence (48,502 bp) and lambda DNA cut with 3 different restrictions enzymes (A, B, C). Page 4 of 5 Introduction to Biotechnology 2024 (a) Calculate the size the resulting fragments will be after digestion by each enzyme A, B and C and complete the table below. lambda DNA cut with enzyme A List fragment sizes in decreasing order of size lambda DNA cut with enzyme B lambda DNA cut with enzyme C List fragment sizes in decreasing order of size List fragment sizes in decreasing order of size (b) How many fragments would you expect to see for each of the DNA sequences cut with an enzyme A, B and C on the agarose gel? (c) Compare the size of the fragments that you have calculated with the bands shown in the Figure 2 and determine which of the enzymes (BamHI, EcoRI and HindIII) are A, B and C. (d) How many times does the sequence GAATTC occur in the lambda DNA sequence? What about AAGCTT and GGATCC? Page 5 of 5See Answer
Q20:Part I: Finding specific types of prokaryotic sequences 1. Why is it relatively easy to find genes in bacterial genomes? 2. Go to the week 7 folder, select E.coli, then copy the entire DNA sequence. These are the first 10,000 bp of the raw E.coli genomic DNA sequence that we are going to study using various DNA analysis programs. 3. Go to http://www.fruitfly.org/seq tools/promoter.html paste the sequence into the window, then select "Prokaryotic," "yes" for "include reverse strand?" and click "submit." • How many promoters does it find on the forward strand? • Where do the three highest-scoring promoters start and end? • How many promoters does it find on the reverse strand? • Where do the three highest-scoring promoters start and end? 5. Go to BPROM - Prediction of bacterial promoters (softberry.com) and click "help.” • How accurate is BPROM? • How far is it from most bacterial promoters to the protein coding sequences? 6. Return to BPROM - Prediction of bacterial promoters (softberry.com) paste the E. coli query into the window then click "process." 4. How many promoters does it find? 5. Where do the three highest-scoring promoters start and end? 6. How do these compare with the previous site?See Answer

TutorBin Testimonials

I found TutorBin Bioinformatics homework help when I was struggling with complex concepts. Experts provided step-wise explanations and examples to help me understand concepts clearly.

Rick Jordon

TutorBin experts resolve your doubts without making you wait for long. Their experts are responsive & available 24/7 whenever you need Bioinformatics subject guidance.

Andrea Jacobs

I trust TutorBin for assisting me in completing Bioinformatics assignments with quality and 100% accuracy. Experts are polite, listen to my problems, and have extensive experience in their domain.

Lilian King

I got my Bioinformatics homework done on time. My assignment is proofread and edited by professionals. Got zero plagiarism as experts developed my assignment from scratch. Feel relieved and super excited.

Joey Dip

Popular Subjects for bioinformatics

You can get the best rated step-by-step problem explanations from 65000+ expert tutors by ordering TutorBin bioinformatics homework help.

TutorBin helping students around the globe

TutorBin believes that distance should never be a barrier to learning. Over 500000+ orders and 100000+ happy customers explain TutorBin has become the name that keeps learning fun in the UK, USA, Canada, Australia, Singapore, and UAE.